Welcome to the EGGhead Forum - a great place to visit and packed with tips and EGGspert advice! You can also join the conversation and get more information and amazing kamado recipes by following Big Green Egg to Experience our World of Flavor™ at:
Want to see how the EGG is made? Click to Watch
Facebook | Twitter | Instagram | Pinterest | Youtube | Vimeo
Share your photos by tagging us and using the hashtag #BigGreenEgg.
Share your photos by tagging us and using the hashtag #BigGreenEgg.
Want to see how the EGG is made? Click to Watch
OT: Vegan sues neighbors for grilling
Boileregger
Posts: 614
in Off Topic
Comments
-
She should sell that house - bet it goes up in value after this story.THANK YOU FOR YOUR ATTENTION TO THIS MATTER
-
What a nightmare neighbor.MMBGE / Large BGE / XL BGE (Craigslist Find) / SF30x80 cabinet trailer - "Ol' Mortimer" / Outdoor kitchen in progress.
RECOVERING BUBBLEHEAD
Southeastern CT. -
Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to pass~ John - Formerly known as ColtsFan - https://www.instagram.com/hoosier_egger
XL BGE, LG BGE, Med BGE, BGE Chiminea, Ardore Pizza Oven
Bloomington, IN - Hoo Hoo Hoo Hoosiers! -
I bet she uses weedkiller on her lawn.
-
At that point..I would make sure and egg everyday...especially on windy days
-
-
Did you puff-puff first?ColtsFan said:Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to pass -
Thought it was “puff, puff, give.” From the movie “Friday.”Eggcelsior said:
Did you puff-puff first?ColtsFan said:Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to passMMBGE / Large BGE / XL BGE (Craigslist Find) / SF30x80 cabinet trailer - "Ol' Mortimer" / Outdoor kitchen in progress.
RECOVERING BUBBLEHEAD
Southeastern CT. -
As long as he doesn't bogart it it's all good.CTMike said:
Thought it was “puff, puff, give.” From the movie “Friday.”Eggcelsior said:
Did you puff-puff first?ColtsFan said:Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to pass
“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk -
talk about entitled.
-
I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.Large BGE with CGS Woo Ring, stone with stainless pan, Smokeware chimney cap, Kick Ash basket and Kick Ash can.Living free in the 603 (Pelham). -
Help me out here, which genetics are those?1911Man said:I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.
THANK YOU FOR YOUR ATTENTION TO THIS MATTER -
We're omnivours. We eat both plants and animals. In fact, if wasn't for us eating animal protein (aka, red meat) earlier in our evolution we wouldn't have developed the brains we have now. If you want a physical manifestation of this, just look at your teeth. We have both incisors and molars. Incisors for cutting through flesh and molars for masticating plants so that we can digest them.Legume said:
Help me out here, which genetics are those?1911Man said:I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.Large BGE with CGS Woo Ring, stone with stainless pan, Smokeware chimney cap, Kick Ash basket and Kick Ash can.Living free in the 603 (Pelham). -
Legume said:
Help me out here, which genetics are those?1911Man said:I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.It's the "eats meat" sequence:taaaaaattacttcttgcagtgactttgtctcgcagtgacgcccattgcccggtcgctcc
tcgggcagaatgaccgttagggaacagccagggaggcttcgcaaagggccaatacctatg
caaccaccttgttttttatcttgagagcccccaagaccgctttttatagcatccacgaca
atatcatattcagtcggccggattcttctgctagcccgcccgcaagaacgcactctttaa
acgggtaacttcggtttttcaagtagggtcgatcgctaagcagcagcgtcgcgcgttcac
gccttacgagtctgtaggaaccatcacaatgggcataccttgagacacattgcaaagtcc
ttctacgatagcacccaacggtctttatgtggaactggggggtgagcgttggatcatccc
tccagtgtcctccaaggtgggaagggcgaacgagagcatagtggacagaatgggaccaat
caagcaccaagcaggagcccgggttgatgagcgtcttcgggcacctcacaatggagcagc
ccgataaatcatcttcccgtgcggaagtccacttaaaatacaaggtcaagaaatgttaga
acacagacagtaactagtttagatcgtctagcagcggtgggtcataatacggagcagtgg
catggtacgtatccgcatttgtgagatgtttggccttcgggtcggtccccattttttgca
caccggttgcgttgagcaattcactttacaacaacgcctgttcaagtacataagaaaatc
cggttccgtaccggatgcagtattttagatacgcaatctcctgagcactcacttgcgtaa
agagactcaaacatgtctaagctggggatacaaggctcagcgctgagcacagaacagaag
tcctcgcacagcaagggaatgcgaggccgccgtcagggatcactacttaacgtttggaaa
gactaaacacaaacgagtggcgagcggactgatctgcgcaYou have that one don't you?
“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk -
Big difference between "CAN eat meat" and "MUST eat meat".1911Man said:
We're omnivours. We eat both plants and animals. In fact, if wasn't for us eating animal protein (aka, red meat) earlier in our evolution we wouldn't have developed the brains we have now. If you want a physical manifestation of this, just look at your teeth. We have both incisors and molars. Incisors for cutting through flesh and molars for masticating plants so that we can digest them.Legume said:
Help me out here, which genetics are those?1911Man said:I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.
“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk -
Yup. Zactly. Our teeth allow us to, don’t compel us to. I have no issue with people wanting to avoid ingesting anything that is animal derived. It’s what it does to their brains that I have a problem with.
THANK YOU FOR YOUR ATTENTION TO THIS MATTER -
She's suing both neighbors according to the news report. That ought to tell you something about who is being reasonable and who is not.Plymouth, MN
-
An interesting column in the NYTimes a few days ago titled "Stop Mocking Vegans" in which the author makes many valid points.I'll continue to mock my sister the vegan on occasion but it's all in good fun (and her brain is still fine... so far anyway).
“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk -
Unfortunately I have run into some vegans who seriously had something wrong. They tend to be “spacey”. With a perfect vegan diet and B12 supplements I suppose some of them can be healthy. The problem is that it becomes a full time job making sure that you get the wide variety that you need.
-
You appear to think the word “interesting” means something different from my understanding of the word.HeavyG said:An interesting column in the NYTimes a few days ago titled "Stop Mocking Vegans" in which the author makes many valid points.I'll continue to mock my sister the vegan on occasion but it's all in good fun (and her brain is still fine... so far anyway)."I've made a note never to piss you two off." - Stike
"The truth is, these are not very bright guys, and things got out of hand." - Deep Throat -
Bill Clinton is a vegan. You can look at his expressions and tell he isn’t playing with a “full deck” anymore.
-
I did have asparagus tonight."Knowledge is Good" - Emil Faber
XL and MM
Louisville, Kentucky -
Gulfcoastguy said:Unfortunately I have run into some vegans who seriously had something wrong. They tend to be “spacey”. With a perfect vegan diet and B12 supplements I suppose some of them can be healthy. The problem is that it becomes a full time job making sure that you get the wide variety that you need.The only thing missing from a strict vegan diet is B12 but that is very easily addressed.Funny thing tho, due to a variety of factors a sizable percentage of the meat eating crowd are also in the low/deficient B12 range and would also benefit from B12 supplementation.“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk
-
I do tend to set that bar pretty low.JohnInCarolina said:
You appear to think the word “interesting” means something different from my understanding of the word.HeavyG said:An interesting column in the NYTimes a few days ago titled "Stop Mocking Vegans" in which the author makes many valid points.I'll continue to mock my sister the vegan on occasion but it's all in good fun (and her brain is still fine... so far anyway).
“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk -
That just means your pee will stink more than usual.YukonRon said:I did have asparagus tonight.Flint, Michigan -
Solid reasoning sir! I always eat carrots using only my molars and I never chew a steak with my molars. The incisors are for cutting and the molars are for grinding. Meat or plants, they serve the same function.1911Man said:
We're omnivours. We eat both plants and animals. In fact, if wasn't for us eating animal protein (aka, red meat) earlier in our evolution we wouldn't have developed the brains we have now. If you want a physical manifestation of this, just look at your teeth. We have both incisors and molars. Incisors for cutting through flesh and molars for masticating plants so that we can digest them.Legume said:
Help me out here, which genetics are those?1911Man said:I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.Flint, Michigan -
This one was great. Sounds like normal East Tennessee lawsuits. I’m still laughing at the You Tube.Large, Small, Mini Max & Mini.
Wishlist XXL, XL & Medium -
BBQ community coming together on this one.
https://nypost.com/2019/09/04/thousands-to-attend-bbq-outside-home-of-vegan-who-sued-neighbors-over-smelly-meats/
-
This is great. Can any Aussie eggers turn this into an eggfest?BugFreak72 said:BBQ community coming together on this one.
https://nypost.com/2019/09/04/thousands-to-attend-bbq-outside-home-of-vegan-who-sued-neighbors-over-smelly-meats/ -
I do hope they throw some seitan- rimp on the barbie for her.#1 LBGE December 2012 • #2 SBGE February 2013 • #3 Mini May 2013A happy BGE family in Houston, TX.
Categories
- All Categories
- 184K EggHead Forum
- 16.1K Forum List
- 461 EGGtoberfest
- 1.9K Forum Feedback
- 10.5K Off Topic
- 2.4K EGG Table Forum
- 1 Rules & Disclaimer
- 9.2K Cookbook
- 16 Valentines Day
- 118 Holiday Recipes
- 348 Appetizers
- 521 Baking
- 2.5K Beef
- 90 Desserts
- 167 Lamb
- 2.4K Pork
- 1.5K Poultry
- 33 Salads and Dressings
- 322 Sauces, Rubs, Marinades
- 548 Seafood
- 175 Sides
- 122 Soups, Stews, Chilis
- 41 Vegetarian
- 103 Vegetables
- 315 Health
- 293 Weight Loss Forum















