Welcome to the EGGhead Forum - a great place to visit and packed with tips and EGGspert advice! You can also join the conversation and get more information and amazing kamado recipes by following Big Green Egg to Experience our World of Flavor™ at:
Want to see how the EGG is made? Click to Watch
Facebook | Twitter | Instagram | Pinterest | Youtube | Vimeo
Share your photos by tagging us and using the hashtag #BigGreenEgg.
Share your photos by tagging us and using the hashtag #BigGreenEgg.
Want to see how the EGG is made? Click to Watch
OT: Vegan sues neighbors for grilling
Options
Boileregger
Posts: 614
in Off Topic
Comments
-
She should sell that house - bet it goes up in value after this story.
-
What a nightmare neighbor.MMBGE / Large BGE / XL BGE (Craigslist Find) / SF30x80 cabinet trailer - "Ol' Mortimer" / Outdoor kitchen in progress.
RECOVERING BUBBLEHEAD
Southeastern CT. -
Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to pass~ John - https://www.instagram.com/hoosier_egger
XL BGE, LG BGE, KJ Jr, PK Original, Ardore Pizza Oven, King Disc
Bloomington, IN - Hoo Hoo Hoo Hoosiers! -
I bet she uses weedkiller on her lawn.
-
At that point..I would make sure and egg everyday...especially on windy days
-
-
ColtsFan said:Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to pass
-
Eggcelsior said:ColtsFan said:Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to passMMBGE / Large BGE / XL BGE (Craigslist Find) / SF30x80 cabinet trailer - "Ol' Mortimer" / Outdoor kitchen in progress.
RECOVERING BUBBLEHEAD
Southeastern CT. -
CTMike said:Eggcelsior said:ColtsFan said:Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to pass
“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk -
talk about entitled.
-
I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.Large BGE with CGS Woo Ring, stone with stainless pan, Smokeware chimney cap, Kick Ash basket and Kick Ash can.Living free in the 603 (Pelham). -
1911Man said:I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.
-
Legume said:1911Man said:I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.Large BGE with CGS Woo Ring, stone with stainless pan, Smokeware chimney cap, Kick Ash basket and Kick Ash can.Living free in the 603 (Pelham). -
Legume said:1911Man said:I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.It's the "eats meat" sequence:taaaaaattacttcttgcagtgactttgtctcgcagtgacgcccattgcccggtcgctcc
tcgggcagaatgaccgttagggaacagccagggaggcttcgcaaagggccaatacctatg
caaccaccttgttttttatcttgagagcccccaagaccgctttttatagcatccacgaca
atatcatattcagtcggccggattcttctgctagcccgcccgcaagaacgcactctttaa
acgggtaacttcggtttttcaagtagggtcgatcgctaagcagcagcgtcgcgcgttcac
gccttacgagtctgtaggaaccatcacaatgggcataccttgagacacattgcaaagtcc
ttctacgatagcacccaacggtctttatgtggaactggggggtgagcgttggatcatccc
tccagtgtcctccaaggtgggaagggcgaacgagagcatagtggacagaatgggaccaat
caagcaccaagcaggagcccgggttgatgagcgtcttcgggcacctcacaatggagcagc
ccgataaatcatcttcccgtgcggaagtccacttaaaatacaaggtcaagaaatgttaga
acacagacagtaactagtttagatcgtctagcagcggtgggtcataatacggagcagtgg
catggtacgtatccgcatttgtgagatgtttggccttcgggtcggtccccattttttgca
caccggttgcgttgagcaattcactttacaacaacgcctgttcaagtacataagaaaatc
cggttccgtaccggatgcagtattttagatacgcaatctcctgagcactcacttgcgtaa
agagactcaaacatgtctaagctggggatacaaggctcagcgctgagcacagaacagaag
tcctcgcacagcaagggaatgcgaggccgccgtcagggatcactacttaacgtttggaaa
gactaaacacaaacgagtggcgagcggactgatctgcgcaYou have that one don't you?
“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk -
1911Man said:Legume said:1911Man said:I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.
“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk -
Yup. Zactly. Our teeth allow us to, don’t compel us to. I have no issue with people wanting to avoid ingesting anything that is animal derived. It’s what it does to their brains that I have a problem with.
-
She's suing both neighbors according to the news report. That ought to tell you something about who is being reasonable and who is not.Mountain View, CA
-
An interesting column in the NYTimes a few days ago titled "Stop Mocking Vegans" in which the author makes many valid points.I'll continue to mock my sister the vegan on occasion but it's all in good fun (and her brain is still fine... so far anyway).
“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk -
Unfortunately I have run into some vegans who seriously had something wrong. They tend to be “spacey”. With a perfect vegan diet and B12 supplements I suppose some of them can be healthy. The problem is that it becomes a full time job making sure that you get the wide variety that you need.
-
HeavyG said:An interesting column in the NYTimes a few days ago titled "Stop Mocking Vegans" in which the author makes many valid points.I'll continue to mock my sister the vegan on occasion but it's all in good fun (and her brain is still fine... so far anyway)."I've made a note never to piss you two off." - Stike
-
Bill Clinton is a vegan. You can look at his expressions and tell he isn’t playing with a “full deck” anymore.
-
I did have asparagus tonight."Knowledge is Good" - Emil Faber
XL and MM
Louisville, Kentucky -
Gulfcoastguy said:Unfortunately I have run into some vegans who seriously had something wrong. They tend to be “spacey”. With a perfect vegan diet and B12 supplements I suppose some of them can be healthy. The problem is that it becomes a full time job making sure that you get the wide variety that you need.The only thing missing from a strict vegan diet is B12 but that is very easily addressed.Funny thing tho, due to a variety of factors a sizable percentage of the meat eating crowd are also in the low/deficient B12 range and would also benefit from B12 supplementation.“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk
-
JohnInCarolina said:HeavyG said:An interesting column in the NYTimes a few days ago titled "Stop Mocking Vegans" in which the author makes many valid points.I'll continue to mock my sister the vegan on occasion but it's all in good fun (and her brain is still fine... so far anyway).
“Reality is that which, when you stop believing in it, doesn't go away.” ― Philip K. Diçk -
YukonRon said:I did have asparagus tonight.Flint, Michigan
-
1911Man said:Legume said:1911Man said:I've said this many times...
Vegans are an abomination... It's unnatural and goes against our genetics.Flint, Michigan -
This one was great. Sounds like normal East Tennessee lawsuits. I’m still laughing at the You Tube.Large, Small, Mini Max & Mini.
Wishlist XXL, XL & Medium -
BBQ community coming together on this one.
https://nypost.com/2019/09/04/thousands-to-attend-bbq-outside-home-of-vegan-who-sued-neighbors-over-smelly-meats/
-
BugFreak72 said:BBQ community coming together on this one.
https://nypost.com/2019/09/04/thousands-to-attend-bbq-outside-home-of-vegan-who-sued-neighbors-over-smelly-meats/ -
I do hope they throw some seitan- rimp on the barbie for her.#1 LBGE December 2012 • #2 SBGE February 2013 • #3 Mini May 2013A happy BGE family in Houston, TX.
Categories
- All Categories
- 182.7K EggHead Forum
- 15.7K Forum List
- 459 EGGtoberfest
- 1.9K Forum Feedback
- 10.3K Off Topic
- 2.2K EGG Table Forum
- 1 Rules & Disclaimer
- 9K Cookbook
- 12 Valentines Day
- 91 Holiday Recipes
- 223 Appetizers
- 516 Baking
- 2.4K Beef
- 88 Desserts
- 163 Lamb
- 2.4K Pork
- 1.5K Poultry
- 30 Salads and Dressings
- 320 Sauces, Rubs, Marinades
- 543 Seafood
- 175 Sides
- 121 Soups, Stews, Chilis
- 35 Vegetarian
- 100 Vegetables
- 312 Health
- 292 Weight Loss Forum