OT: Vegan sues neighbors for grilling

Boileregger

Maybe she should just move...

https://www.usatoday.com/story/news/world/2019/09/03/vegan-sues-her-neighbors-barbecuing-their-backyard-australia/2196077001/

Legume

She should sell that house - bet it goes up in value after this story.  

CTMike

What a nightmare neighbor. 

ColtsFan

Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to pass

Gulfcoastguy

I bet she uses weedkiller on her lawn.

DuckDogDr

At that point..I would make sure and egg everyday...especially on windy days

FanOfFanboys

first we let women vote. now this

Eggcelsior

ColtsFan said:

Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to pass

Did you puff-puff first?

CTMike

Eggcelsior said:

ColtsFan said:

Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to pass

Did you puff-puff first?

Thought it was “puff, puff, give.” From the movie “Friday.”

HeavyG

CTMike said:

Eggcelsior said:

ColtsFan said:

Funny because one of the houses we recently looked at had a covenant of "no offensive smoke coming from your property"....We had to pass

Did you puff-puff first?

Thought it was “puff, puff, give.” From the movie “Friday.”

As long as he doesn't bogart it it's all good.

RockyTopDW

talk about entitled.  

1911Man

I've said this many times... 
Vegans are an abomination... It's unnatural and goes against our genetics. 

Legume

1911Man said:

I've said this many times... 
Vegans are an abomination... It's unnatural and goes against our genetics. 

Help me out here, which genetics are those?

1911Man

Legume said:

1911Man said:

I've said this many times... 
Vegans are an abomination... It's unnatural and goes against our genetics. 

Help me out here, which genetics are those?

We're omnivours. We eat both plants and animals. In fact, if wasn't for us eating animal protein (aka, red meat) earlier in our evolution we wouldn't have developed the brains we have now. If you want a physical manifestation of this, just look at your teeth. We have both incisors and molars. Incisors for cutting through flesh and molars for masticating plants so that we can digest them.  

HeavyG

Legume said:

1911Man said:

I've said this many times... 
Vegans are an abomination... It's unnatural and goes against our genetics. 

Help me out here, which genetics are those?

It's the "eats meat" sequence:

taaaaaattacttcttgcagtgactttgtctcgcagtgacgcccattgcccggtcgctcc
tcgggcagaatgaccgttagggaacagccagggaggcttcgcaaagggccaatacctatg
caaccaccttgttttttatcttgagagcccccaagaccgctttttatagcatccacgaca
atatcatattcagtcggccggattcttctgctagcccgcccgcaagaacgcactctttaa
acgggtaacttcggtttttcaagtagggtcgatcgctaagcagcagcgtcgcgcgttcac
gccttacgagtctgtaggaaccatcacaatgggcataccttgagacacattgcaaagtcc
ttctacgatagcacccaacggtctttatgtggaactggggggtgagcgttggatcatccc
tccagtgtcctccaaggtgggaagggcgaacgagagcatagtggacagaatgggaccaat
caagcaccaagcaggagcccgggttgatgagcgtcttcgggcacctcacaatggagcagc
ccgataaatcatcttcccgtgcggaagtccacttaaaatacaaggtcaagaaatgttaga
acacagacagtaactagtttagatcgtctagcagcggtgggtcataatacggagcagtgg
catggtacgtatccgcatttgtgagatgtttggccttcgggtcggtccccattttttgca
caccggttgcgttgagcaattcactttacaacaacgcctgttcaagtacataagaaaatc
cggttccgtaccggatgcagtattttagatacgcaatctcctgagcactcacttgcgtaa
agagactcaaacatgtctaagctggggatacaaggctcagcgctgagcacagaacagaag
tcctcgcacagcaagggaatgcgaggccgccgtcagggatcactacttaacgtttggaaa
gactaaacacaaacgagtggcgagcggactgatctgcgca

You have that one don't you?

HeavyG

1911Man said:

Legume said:

1911Man said:

I've said this many times... 
Vegans are an abomination... It's unnatural and goes against our genetics. 

Help me out here, which genetics are those?

We're omnivours. We eat both plants and animals. In fact, if wasn't for us eating animal protein (aka, red meat) earlier in our evolution we wouldn't have developed the brains we have now. If you want a physical manifestation of this, just look at your teeth. We have both incisors and molars. Incisors for cutting through flesh and molars for masticating plants so that we can digest them.  

Big difference between "CAN eat meat" and "MUST eat meat".

Legume

Yup.  Zactly.  Our teeth allow us to, don’t compel us to.  I have no issue with people wanting to avoid ingesting anything that is animal derived.  It’s what it does to their brains that I have a problem with.

dmourati

She's suing both neighbors according to the news report. That ought to tell you something about who is being reasonable and who is not.

HeavyG

An interesting column in the NYTimes a few days ago titled "Stop Mocking Vegans" in which the author makes many valid points.

https://www.nytimes.com/2019/08/28/opinion/vegan-food.html?action=click&module=Well&pgtype=Homepage&section=OpEd+Columnists&fbclid=IwAR2kovED8DWLw7tOeBrBXN_8qSmH0zn8x23rRxWu3TDsxPm2_u0VyPAmTio

I'll continue to mock my sister the vegan on occasion but it's all in good fun (and her brain is still fine... so far anyway).

Gulfcoastguy

Unfortunately I have run into some vegans who seriously had something wrong. They tend to be “spacey”. With a perfect vegan diet and B12 supplements I suppose some of them can be healthy. The problem is that it becomes a full time job making sure that you get the wide variety that you need. 

JohnInCarolina

HeavyG said:

An interesting column in the NYTimes a few days ago titled "Stop Mocking Vegans" in which the author makes many valid points.

https://www.nytimes.com/2019/08/28/opinion/vegan-food.html?action=click&module=Well&pgtype=Homepage&section=OpEd+Columnists&fbclid=IwAR2kovED8DWLw7tOeBrBXN_8qSmH0zn8x23rRxWu3TDsxPm2_u0VyPAmTio

I'll continue to mock my sister the vegan on occasion but it's all in good fun (and her brain is still fine... so far anyway).

You appear to think the word “interesting” means something different from my understanding of the word.

littlerascal56

Bill Clinton is a vegan.  You can look at his expressions and tell he isn’t playing with a “full deck” anymore.  

YukonRon

I did have asparagus tonight.

HeavyG

Gulfcoastguy said:

Unfortunately I have run into some vegans who seriously had something wrong. They tend to be “spacey”. With a perfect vegan diet and B12 supplements I suppose some of them can be healthy. The problem is that it becomes a full time job making sure that you get the wide variety that you need. 

The only thing missing from a strict vegan diet is B12 but that is very easily addressed.

Funny thing tho, due to a variety of factors a sizable percentage of the meat eating crowd are also in the low/deficient B12 range and would also benefit from B12 supplementation.

HeavyG

JohnInCarolina said:

HeavyG said:

An interesting column in the NYTimes a few days ago titled "Stop Mocking Vegans" in which the author makes many valid points.

https://www.nytimes.com/2019/08/28/opinion/vegan-food.html?action=click&module=Well&pgtype=Homepage&section=OpEd+Columnists&fbclid=IwAR2kovED8DWLw7tOeBrBXN_8qSmH0zn8x23rRxWu3TDsxPm2_u0VyPAmTio

I'll continue to mock my sister the vegan on occasion but it's all in good fun (and her brain is still fine... so far anyway).

You appear to think the word “interesting” means something different from my understanding of the word.

I do tend to set that bar pretty low.

Fred19Flintstone

YukonRon said:

I did have asparagus tonight.

That just means your pee will stink more than usual.

Fred19Flintstone

1911Man said:

Legume said:

1911Man said:

I've said this many times... 
Vegans are an abomination... It's unnatural and goes against our genetics. 

Help me out here, which genetics are those?

We're omnivours. We eat both plants and animals. In fact, if wasn't for us eating animal protein (aka, red meat) earlier in our evolution we wouldn't have developed the brains we have now. If you want a physical manifestation of this, just look at your teeth. We have both incisors and molars. Incisors for cutting through flesh and molars for masticating plants so that we can digest them.  

Solid reasoning sir!  I always eat carrots using only my molars and I never chew a steak with my molars.  The incisors are for cutting and the molars are for grinding.  Meat or plants, they serve the same function.

RalphieBoy

This one was great. Sounds like normal East Tennessee lawsuits. I’m still laughing at the You Tube.

BugFreak72

BBQ community coming together on this one.
https://nypost.com/2019/09/04/thousands-to-attend-bbq-outside-home-of-vegan-who-sued-neighbors-over-smelly-meats/ 

Boileregger

BugFreak72 said:

BBQ community coming together on this one.
https://nypost.com/2019/09/04/thousands-to-attend-bbq-outside-home-of-vegan-who-sued-neighbors-over-smelly-meats/ 

This is great.  Can any Aussie eggers turn this into an eggfest?

caliking

I do hope they  throw  some seitan- rimp on the barbie for her.